The Anti-5-Hydroxymethylcytosine (5hmC) Antibody (CAB20140) is a crucial tool for researchers studying epigenetics and DNA methylation. This polyclonal antibody, raised in rabbits, is highly specific and reactive with samples containing 5-hydroxymethylcytosine (5hmC), a modified form of cytosine found in DNA.Validated for use in multiple applications, including immunohistochemistry and chromatin immunoprecipitation (ChIP), this antibody binds to the 5hmC modification on DNA, allowing for precise detection and analysis in various biological samples.
Its versatility makes it ideal for research in fields such as cancer, developmental biology, and neurological disorders.The presence of 5hmC in DNA has been linked to gene expression regulation, stem cell differentiation, and neurological functions, making this antibody essential for understanding the role of epigenetic modifications in health and disease. By using the Anti-5-Hydroxymethylcytosine (5hmC) Antibody, researchers can unravel the complex mechanisms of DNA methylation and its impact on cellular processes.
In mammalian genomes, 5-mC can be enzymatically oxidized to 5-hmC (5-hydroxymethylcytosine). This modification is suggested to be an intermediate between methylation and demethylation of the genome. Occupancy of 5-hmC correlates with inactive or non-productive promoters (PMID: 21925312). 5-hmC pattern is different from 5-methylcytosine (5-mC) in many instances(PMID: 21610077).
Purification Method:
Affinity purification
Storage Buffer:
Store at -20℃. Avoid freeze / thaw cycles.Buffer: PBS with 0.01% thimerosal,50% glycerol,pH7.3.
Dot-blot analysis of 5-Hydroxymethylcytosine(5-hmC),5-Methylcytosine (5mC) and unmodified adenosine using 5-Hydroxymethylcytosine/ 5-hmC antibody (CAB20140) at 1:500/1:2000 dilution.m5C 1 - 5’CAGTAACTGTGGTCCGGTAACTGACTTGCA3’m5C 2 - 5’CAGTAACTGTGGTC/i5MedC/GGTAACTGACTTGCA3’
